Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D032E05
Clone ID D032E05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D032E05
Sequence
ACTTTTAAAAGCTCTGTGCTCCAAGTTAAAAAACGCTTTTACGAGGTATCAGCACTTTTCTTTCATTGGGGGAAAGGCGT
GAGGGAAGTGCNNAACAGCAGCAGACTTTGAAACTTTAAACAGACAGGTCTGAGAGGCCGAACTCTCCTTTTCCTTTGAC
TTCAGCCTCCAAGGAGTTCCACCACTTTGGCGTGCCGGCTTCACTTTCATTAAGTGAAAGG
Sequence Type mRNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56097104..56097323 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]


SPLK-Sequence tag 5SD032E05
Sequence
ATCAGAGGGNNNNAAGCACTAAGCAAAAATGATGCTAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD032E05
Sequence
TTTTAATTGGTAACACATTCTGTAAGCACTTTGACCGGCCTAAATCCACACCGAAGTATCAGGGTGGGTCTGTATTGAAG
GGCTTTTTTTTCTGTACCAGACCAGGCCGAGTCGTTGTGAAGTGAAAGCTTTAGGGCAGAGGATGGCACGGGCCCCTCCT
GCCCAGTCTTAGCATCATCACGGGCTCCGTTCGCGCTTCCCGCAGCCTCCCAGCTTCGCGGTCCAGACGGCTGGCTGCGG
AGGGGGGGAGGGGAGGCCAGGCTCGCGGCCCGACGGTCAGAAAGCAAGTGGGCGACTTTATTAAAGTTGTCAGTCTGAAG
TCCCCCGCGCCCTCCCAGTCGCCTTTTCACGGTTTCTCTGCCTAAACTCGTCGGGTGGCTGAGTGGAGCCCCTGGGAAGG
TCCCCTAAACACCTAGGGAGTCCCGGTGCTGGTAAATGCACTTGTAACACTCCTGGAAACTCTTGAAATTCCCCAAGAAT
GAGGCGGGGCGGAAGAAGGAGGGGCAAAGAAGACCCTTCGAGAAACCCTGCCATAGCTACTGACGTGTGCTGAGGCAAAT
CCGTTCAGGATTGGGAAATTCAAACCTTGACTTCCGAGCAGAGTTCTCCCCGTGAGTGCCCTCGG
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56098335..56098960 622
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es