Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D032D05
Clone ID D032D05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD032D05
Sequence
GCTGAGAAACATGTTCTGTGCTTCTCTGGTCTCCTGGGGGTGTGTTGTTGTCAGCTGTCCTCAGGTGTGGAATGGGGACT
CCCAGAAGGAGGGCACTATAAACTGGAAACTGCCCACATAGAGGAAGGATGTTAGCTAGCTTGTTTTAGCTACTGAAAGG
AACAGGCAAGTAAATCATGAAATGAGTCA
Sequence Type genomic DNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29208182..29208370 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es