Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D031F01
Clone ID D031F01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D031F01
Sequence
ATTAAATGAGTGGGGGGTGGGGGGTAATTACCAGACGTAACTCCGTGAGTCTTACGAGTCCAGATTCGCAATCGAGCCGG
AGTGGGCCCCGCGAGACAGTGTTTGCAGCGGGAACATTTCGGTATCTTTGATCCGAGTGAGGACACAGCGCAGAAGCTAA
GGATGAGCGACGCGGATCTGAGTCGTCGCTGGGTCATCANNCTGCNNNCTGCTGCTGCCGGAGTAGCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD031F01
Sequence
TTACTAACAAACCTGCTTAGGCGATACTGTTACGGGGGTAAAATGGGCACAGTCGATGCCGGGATTGGGGTGACCGTATC
CTGACCAGGCCCGTCATCAGGCCCCTGATGTTCAGGGTGACTGTGAAAACACTTGTGTAAATGTTTGTTCACCAGGGTTG
ACCTCCAATTGGGCTTCGTTCCCATAACAACAGGAGCCAGCCCTGACTTAGAACCAGCCATTAAGGCCCCTCCCCACATC
AAAAAACATACCTCTGATGGGCAGCTGAAGGGCTCAGGGTGACAGCTATCATTAAGTCCTGGTCCCATTAAATCTTTATC
AGGAGAAGGGTAGTTTTGGCAGGTGGTGAGATGACCCAGGATGACAGCCTTTAGAAAAGATCACTGTATTTAAAAACAAT
TCTG
Sequence Type genomic DNA
Unitrap ID UNI11543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21531080..21531484 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032193 (Ldlr) NM_010700 low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

 
Come back to gene ENSMUSG00000032193


For any suggestions or comments, please send an email to unitrap@crg.es