Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D031B07
Clone ID D031B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D031B07
Sequence
GTCTGGGCGTTCGTGTGTTCGATGATCTTTTGCGGCGTCTTCTTGGTTGATGTCTCCGGAGCGGCGGCGGCTGTGCCAGG
TCCTGGACTGAGTTATCCCGGAGGCCCCGGGCTCTGGCCGCTTTCTNNNGCTGGTCGGTCGAGCGGACCCCTCGCTTTCT
TCGGCCTCTCCCCGCCTTCCGTCCGTGGCTCCGTGCGCTCGCTGGCTTTCGGGCCGAGCTCTCACTCTCCTCGCAG
Sequence Type mRNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91570301..91570536 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]


SPLK-Sequence tag 3SD031B07
Sequence
ATCCAAGGAATCTCTTTTGAAACTTTTTTTTATTTGGTTAGTGATTTAGTCATTTTATTCAAGAGTTCAAAAGTCTGTGT
AGAAATTATTCAAACATAATTGAAGATGAATCATTTGTGAACTTTACTGTTTC
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91571483..91571615 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es