Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D030H02
Clone ID D030H02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D030H02
Sequence
TTCGAAGACGACCTTCCTTGCTTTCAGAATTTCACCCGGGTTCTGACAG
Sequence Type mRNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62247065..62247113 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 5SD030H02
Sequence
ACATGATTAACTGTGCTTTTGGGTTATTTGAATTCTTTATAAAGCTTGTATATTAGGTAT
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62239668..62239727 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SD030H02
Sequence
TTTCTGTTTCCTTTATTCATTTGTTCTGCAGAAACTTTTGAGCTTGATATATAATCCCAGGGATTTACTTTTC
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62239572..62239644 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es