Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D030E11
Clone ID D030E11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD030E11
Sequence
AACTTTTTGCGGCCTACTTGAGCCTACCTGATTTGAATAATATATATGGGTTGAAAACCTGTATCAGAATCGTAAGGAAA
AAATTATACTAGTCAAGTTTGGAAGCATATATAAACTTTTCTGTCATCTTAGCTTTTTCCCTTTTCACCCCTACCCCTTT
AGGCTGTGGTTTTGTGGCTTTCCTACTGTGTTGTTGTTGTTGTTACTATTTGCAAGTGTTATTTCTGTATTGTCTCCTAC
ACATACCTGAACAGCTATTAAGCTGAACAATTATTAAGTAGAGTAGATATTATG
Sequence Type genomic DNA
Unitrap ID UNI6873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106078908..106079201 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es