Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D030A11
Clone ID D030A11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D030A11
Sequence
TCCGGCTGCTGTGGAATTTACAGCATAGCCCAGAACTCGAGGCGTCTGCTTAACCCGGCTTCTCAAATGTTGGCCTATAG
Sequence Type mRNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947063..53947142 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 46480794..46480873 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079575 (AC158680.4) NP_001074396 SUH_MOUSE Isoform 2 of P31266 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:P31266-2]


SPLK-Sequence tag 5SD030A11
Sequence
ACTGCCGTTCTCTTTCTTCCATTGTCTTTCTCGTGTGTATCCCCTCCTCACCTTTTTCTCTTTGG
Sequence Type genomic DNA
Unitrap ID UNI15611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53982532..53982595 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es