Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D030A05
Clone ID D030A05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD030A05
Sequence
TTTGTACCTTCATCTGTTTGAATCATGTGGGAAGAAGAGTGATTCCTAACGTTAGCTTCTTGCCTCCACAGTGTAGGCTC
ACACAGGTACGACATCCATACATGCATGCGGTCCACTGCTCGTACATACATGAAGAAACAGAGAAAACAATCTTTTAGAT
GAACAAATGTTTGTTAAGTATCCACTTGTTACCCACCATTATATCGTAATTAAGAAGTGCATACATAGTTACTTGTCTTA
AAGTCGGAGCTAGGGACCAAGGCACAAGTCTCTACCCCTGAGGAACGTTGCAGAGTGGAGGTAGGTGGCAAGTAACCTAA
TGATTATTATTCAGAGTGATAAGGGCATTGTCAAAACCTGTCATCCCCATCACTGAATATTTTACCAGCAGAGAAAAAGT
GTCTACCCATTGAATTAAAAAAAACTGCAGTGACTGCTGCCTGTGCCTGCGTTTCCTGCACACGCTGGTCTCTGTGTGCA
TCAGCATCCAGACTACACAGAGCTAGCACTGTCCCTGAGGTGGGTATTATTGTTAGCAACACTTACAGAGTATAGGAGAG
GAGCCGAAATGTCGTCACTAT
Sequence Type genomic DNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55274662..55275240 558
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]


SPLK-Sequence tag 3SD030A05
Sequence
CAGTCTCATTCCTGGGATTCACTTCTTTTTTAACCCCCATACCGG
Sequence Type genomic DNA
Unitrap ID UNI10852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55274594..55274637 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es