Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029G02
Clone ID D029G02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD029G02
Sequence
TGATTTACTTTTAATTCTGTGTATATATCAGTGTATCACATGAGTGTGGTTGTCCACGGAGTCCAGAGATGTTAGCTGCT
CTGTTATGGTTGAAGGGAAGGTTTCTGTTGTAGATATGAGGGTACAGNNAGAGGCATCCAGAGTAAGGCGAGAAATAGTA
AACGGGGCGTGGTCCGAAGACCTGACTTAGCTCCGAGAGGAGAAAGGTGGGGGTGCGAGAAGGGCGAGAGAG
Sequence Type genomic DNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103241331..103241562 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]


SPLK-Sequence tag 3SD029G02
Sequence
AAGCATTTCAGGGAGAACAGCTAGCTCCCTTAGCAAATGGTTTTGGGATAAACAATTCATGTGAGACGGGAGAGTTTCCT
ATGTTAGGAACTTAACTAAAATGAGTTCTAGGTTAGTTTACTATTGAAATGTGAAGTACAAGTGGTACTAGGAAAAAGGA
AAAGCACGTGTTAGTGTAGGCTGGGGGTCACGAAAGCCTTTCAAACATAATGCTGGAGTCAGAAACAAGTTCAAAAGCTG
CAAAAGAGAAAGGAATCCAGAAAGAGAAACAAACTGTTCAAAGTGTCAGCAATAAATGTGACAAAGGTATTTTTCATGTC
CATAGCAGGTAAACACAAGAACAGCGCAGC
Sequence Type genomic DNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103241932..103242282 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es