Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029E07
Clone ID D029E07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD029E07
Sequence
GATCTGCAGGCCCTTGGAGGCTTAAAAAGCCATTTTTCTGCGCCCCTCCCCTTNNNATACAGCAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD029E07
Sequence
CCCTTTGAGCCCCAGTGCAGCTCTCGGGGCTCCTAGCTAGCTAGTTTTGCTTTGAGCAGTGTCGGTTGGGTTGTGTTGTT
TTGTTTACTGGGCTATGGTGTTGGAAGGTAGCGTATAAGGTGCTTATAATAACCACACAGACGACAGGGTTGAGGGAGTA
GCTTAGTTGGTGGAGTGCTTGCTTGCCTAGTACTACACAAACCGGTTGTGATGACCTCGCACCCAGTACTTGGTTAAGAG
GAGACAGACGGCTGTTTCTTTCGTATCAGAGCTAACAAAACGGAAAATAAGCATGAAATAACTGGTAGGTAGTGAAATGG
AGTAAAATCTTTTAACACGTA
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75495969..75496309 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es