Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029E02
Clone ID D029E02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD029E02
Sequence
GGAGGGGGTGCTGATATATTCCCTTCCCCACCCCCAACTTGTTTTCTAACAGTATTATGTTTTCAATAGACCTGCTTGCC
CTGGGAATTTGGACTTTGTTCTTTCAAATGTAGCTCCA
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649357..66649472 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


SPLK-Sequence tag 3SD029E02
Sequence
CTAGATAGTTTAGTTTTATTATTTTCCTTTGTTGAG
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649521..66649556 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es