Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029D11
Clone ID D029D11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D029D11
Sequence
GAACAGCGANNNNACANNNCTTATCTTCTNNAACACANTTTATTGGATAGGCGGGGAGCCGGGTGTGCCATTCCATCATA
GCGGAGCTGACGGTGGAGGTTCGCGGCTCCAACGGGGCTTTCTTCAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD029D11
Sequence
GATCTTTTCCCCTTGTATCTTTAACTGCAGACAGTCCAGGAACATAAAGGTGTTTGAGTCATAAATTAATAT
Sequence Type genomic DNA
Unitrap ID UNI2391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33929734..33929805 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]


SPLK-Sequence tag 3SD029D11
Sequence
ATGGAGCAGCAGCATTAATGCTCNNGAGCATGGCTTTTGAGTGTCTGAGGGTGCCTCAGTATTAAGAAGCTCCAGTCCCT
TGCAG
Sequence Type genomic DNA
Unitrap ID UNI2391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33929827..33929911 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027680 (Fxr1) NP_001106659 fragile X mental retardation gene 1, autosomal homolog Gene [Source:MGI Symbol;Acc:MGI:104860]

 
Come back to gene ENSMUSG00000027680


For any suggestions or comments, please send an email to unitrap@crg.es