Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029C09
Clone ID D029C09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D029C09
Sequence
TAGTCACGTGCCGTAGGGTCCGCAGCGTGGCGGTGTGTGGCGGTAGCGTCGGCGGGCCGTAGGGCAACCGGAAGGTTTCC
GGTTCCGGTGTAACGTTCGGGCTCCGTCTCAGGGGCTGAAGTTTGTGAG
Sequence Type mRNA
Unitrap ID UNI10936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95659672..95659800 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015748 (Prpf3) NM_027541 PRP3 pre-mRNA processing factor 3 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918017]


SPLK-Sequence tag 5SD029C09
Sequence
TTCTGAGGTTGCATTTTTTAGATGTCTTTAAACATCTTGAAAGAGTAATTCCCAGATCATACTAAGATGCATGGCAGTGC
TAAGAGGAGGTCTTATGGGAAGTTGAGGTCGGTGCAGTCAATAGATTGACATGCAGCCATTAGGAAGAAAATCAGAAATT
AAGTTATCTTTATGCTGGTGAAGATGTTGAGATTTAAGATTACCCAAATGTAAGCATGAATAGTGTTGAAATTTTTCTCC
AACTGTGTTAAGTAATAAAAAAATCATGTTGGTGTATAGAATACTTACCAGCATGAATAAAACTACAGAGAAAGGTGACA
GCATTCTTAAGGATTATGAGATTTAACACAGGAGGACTGACTTGAATAAACCCTCTTCTTTGAATCCGTTAGACAAGTTT
TAGGTCAAAGTTAGGT
Sequence Type genomic DNA
Unitrap ID UNI10936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95658054..95658469 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015748 (Prpf3) NM_027541 PRP3 pre-mRNA processing factor 3 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918017]


SPLK-Sequence tag 3SD029C09
Sequence
AGTTGACTTCTAGATTGACTCTTCAGATGTTCTGTTTGCCAGTCTTTTGTGTGACAGGGGCAGAGTTAGAACCCATTCGT
CAGATTACGTTATTCCTAGTTTGTTCATTCTTTAGATAGCAATGATGACTGATGCTGAGTTAGAATTAAAATATCAAATG
AGTG
Sequence Type genomic DNA
Unitrap ID UNI10936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95657867..95658030 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015748 (Prpf3) NM_027541 PRP3 pre-mRNA processing factor 3 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918017]

 
Come back to gene ENSMUSG00000015748


For any suggestions or comments, please send an email to unitrap@crg.es