Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D029A11
Clone ID D029A11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD029A11
Sequence
CCTGTAGGAGGCGGGAAAACTCCATTGTTTGGAGTGGATGCTGCTTTTGCCGGGTCGGTGGGGCGCAATGAATTTTATTA
TATGCTCCCTACCAGGTTTTCAGTAATCGTGAGTGGGGCTGCGGGTCTGAAGCTTTGTAACTCTTAACCTTTGCGGAGAA
GTGTCTTGATTCGTTAGGTTTTCGGTATGTGGGACGGGGATTTTGTTGCTTCAAGGGACACTTTACTTGCGTAGTGTCTT
CGGTAAAGGCTGTATGTAGCTATCAGTCTAGTGTTTACTTGCTAGATGAGTTTGCTAAGCGAAAGGACCCCAAAGGAGGA
ATGCTTGATTTGAGAGCTTTAAAGTGCTAATCTAACTTGATCTCTCCCATATGCACAGAAGCATTCATCAGTTCGAGG
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116298990..116299387 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SD029A11
Sequence
GGTTCGATTTTCCAGTTTACCTTGCCTTTTTTAGGTCCTGGATTCTATTTTTTTCTGTCCCTTGAGCA
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116298901..116298968 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es