Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028D08
Clone ID D028D08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD028D08
Sequence
TGCCAACTAATCTTTCATGTAACCAGTGTACACTGTAGATAGCCAGTTTGTCTGGGTCTAGTTACTATTTCTACTTTTTC
TCTTTTCTAGGTGTAAAGTCAAGGCAGGGTTAGATGGCCTATATGCTTTGAGCCTGAATCTAAGGTTGATTTAAAGGTTC
AAGCCNNNAAGCTGAAATATCTCGAGGTAGAAGGTAGAAGGAAGCAGAACAGAAAGAAAGCAGTTGAGCAGAANNNAGGA
ATGTTAAACTAGAGCAAGAGGGTTCAAGAAGAAAAATGTAGAGTACTGAGATAAGNNNCAAGGGCTGGAAGCTCCCGAGT
TGGTTTATGTGCCACCACCATCATTCGCTCGCCATACTCTCCTAAACATGTACAGACAGGCTCCCAAGCTTCCAGAGAAC
CAACTCATTTGGCTGATAGGACCCCTTACTGCAACAGATTTATGTTAGACATTGCTTCTTAGTTCTCATGCCAACTTTGC
AAGATCAGTACATTTCTGTTATATACATTATCCAAGGCTTATATATCTACATTTGTCCTCTGGTAGTTGAAAGTGAATAT
AAAATGTCAGAGAAAAAAGAAATTCAGTACATAGCAAACATTGTGCAATTAATATTCAGTACTTTCTGTCTCTTAAACAG
CTTTGTTTTGTGAGATAGCCATTTCTCTGACTTCACTCTCTGACATTACAGCATCAGGCAGGAAATTTTTGTTGTTGTTG
TTTTTAAGACAGGATATACTGATCAACTTATATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21746411..21747168 740
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]


SPLK-Sequence tag 3SD028D08
Sequence
CTCTTGCCTTGGNNTCACTGACGCTGGTATTACAGGAATATTTCACTACATGTCTACTATAATAGGTAACAGAGGGGAGG
AAACAAGACATAGGGGAATCTGAAAATAATGTAATTATTTTATATAAGAAACTGATTTTTCTTTACTATAGGAAGAATAC
TCATTAGTTTGTTGTATTAATTTATTATAATCTTAATACGAAAATGTAATGAGAAAGATAATTTAATGAGAGGCAAGGAT
ACGTTAAGTCCATCNNNGATCTTGTATATAAGTACAATTTTTGTTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es