Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D027F12
Clone ID D027F12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD027F12
Sequence
GTCTTCAGCTGGGGCTCAGTTTTATGGGCTTTACAATAATTTACAAGAACATTATTTTATTCACTTTAATTTGGATGGAG
AATGATCTTTCCATAGAGGGCATTTATAGGTAACCAACTCCTTCCTTCTCAAAGCTTCAACTAGGAAGGTTGGAAAAGGT
AACACTGTCAAAGACTGAATTGAATTGATCAAATCTAGAAGGAAAAGCCCAGAATTATAAAATATATTGTTGCTGATTTG
TACATCCTATCTTTGGTAGCCAATAAAGTATTTAAGGA
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32419399..32419676 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es