Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D027F01
Clone ID D027F01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD027F01
Sequence
GATCTACCTGCCTTTGCCTCCCAAGTGCCAGAACTAAAGGCGTGCATCCTCCACACCTGGCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106730233..106730299 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]


SPLK-Sequence tag 3SD027F01
Sequence
AAAGTTGNTCTTTGAGCAGACTTTATCTTTCAGCATGTAGTCCTTCCTGACTGTCCTGGAACTTAGACAGATGGTCCTGC
TTTTGCCTCTGGGATTAAGGGCATTTGTGATAGCGCATCTGGCTTTTTTTTTTTTTTAAAATTATTTTATTTTTTAAAAC
CCCCCTTAAAAAAAGGGGAAAAAAGGGGGGAAAAAAGGGCCCCGGGGTAAAAAACCCTGGTTGTTTTTAAAAAGGCCCGG
GGTTCATT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es