Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D025E05
Clone ID D025E05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD025E05
Sequence
GAGCAAGGCAAATGAAATCCGGGCAATAATTAGCAGATCAAAAAATCCGCAGGTGGTCAAGGAGAAGGGGCTTACAGTAC
TTAAAGGAAAATTAGCATTTTCTCAAAAGGGTTCCAAATGCCCTTTGTGCTAAACTGGATTACAACCTTCAGCTATTACG
ATTCCCAGGTTTTTAGTAATTTAGCGCTCCTCGCCATCCTTCATCGACCTGCCTGTGCCTGGCTTAGTTAAGGTTTCAAG
CTAATTCAGTCTTCCCCCCAAAAGGGGGAGGGGGCTTCTTTTTTATTCATTTAATTGCATGTAAAATGTGCTCCCTAACC
CTCGGAGGTTCTCCACTGCCAGTAAACGATACTTTGTCATTGGTGATGGGGATTAAGGGGATTTCAGTTTAAGT
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589915..168590307 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


SPLK-Sequence tag 3SD025E05
Sequence
CGTTTTGGGGGACTGAGCATGGTTATTTTTGAATCTCCTCCTTTTGGATGTAAAATGTCAAATGAGAATTTGGGGAAAAG
AATTTTGGCAGGATTCAGTACGAGGAAGCTCGGCGTTGCATTCTGGGTGTAACCTTGCCTAGGTGGACTAGTGTACCCCC
ACTTATTCACCCAGCTTTTTGGGTCCTTGTGTACAGTGGCAGTGAAAAAGTTTTCTATAGACTCCTTGCATGTTGAGGAA
ATTTCATCCACGGAATGACAGTTTTCACTGGAACCTGCTATGTGGCAGGCTCCAGCCNNGGACCTCGAAGGACCTCACCG
TTAATTCTCACAACCTGAAGTAGTTTTGGGATTTCGCTCCCTTGAATAAAGGCTCTCGGGGGCAAGGGTCGCCCAGGGGT
TCCCCTCCCACTTGGNTTTAGCCTTCTTGAATCCATGGGGTGTTTGGTGGTGGGTTCTAGAGCAAGGGGGGATGTACTCA
TTAGGAAGGGACAGCCTAGCCATGGGGCTTTNAGCTGCTTTTGGTTGGGGG
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589372..168589900 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es