Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D025E04
Clone ID D025E04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD025E04
Sequence
GATCTCTCTACTTGGACGAAGTGGTTTTAGGTAGTACTTT
Sequence Type genomic DNA
Unitrap ID UNI12966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700588..151700627 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]


SPLK-Sequence tag 3SD025E04
Sequence
AATGTTTCCGTGCGTTTGTGTGCGTTTTGGGTTAGAATCTTGTTGGGAATTTTTGGGGTCCATCGAGGGTAGGTGCTGTT
GCTGATCTGACCATTTCTCGGGGCAGGATTTAAAAGCAGTTAATTTGGTTGGTAGTGGGAAGACACATTGGGTAGAACAA
TCCTGGAGTAACTGAAAGGTTGACTCAGTGCAAGTTGTGTGGACGGTCTCTTGAACGTGAAGCAAGAGAGTGGGTTTTTC
GCGAACTGCAAAACATGAGTAGCACAAATCCAGGTGAGTTGTTTCAGGGGTCTGTAGAGAGAGGATGTTAATTTTTGTAA
AAGTCAACTGGACCCTCTTCCAGGGTGTAGTTTGGAAGTGCTAAGTCACTGGTTAAGCCAGACACGCTGAAAGTCGTTGA
CCACACTCTTACCTTTAGGGTTGACACCAGACTCAGTCAGTATCATTCCTCTGCCATTCCTGAGAGGGTGGGTCTGTGGT
GTGGGGATTAGATGCTAGGGAGGCAGATGAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es