Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D025D01
Clone ID D025D01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD025D01
Sequence
GATCTCGCTCCGGGGCCCGTCCAGCCCTTTGACCCGNCTTTCGCTGCCTTATTTGGAGCTCTCTGTGAATGGCTGCCTCT
GTGCGTGGCCGATGGTGTCGCGCACTTCTGGGGAAGCTTTTCCGAGAGCACTGCAAGGCGTTCCTTTCTAAGGNNACCCG
GCTCACACTCTTAATCCTGCATCGTTCTCAGCTGTG
Sequence Type genomic DNA
Unitrap ID UNI12760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35379156..35379351 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]


SPLK-Sequence tag 3SD025D01
Sequence
GCGACTTTTAAATTAACTTTGGCAGCGNNNNNCCGAACCTTGCGGCCTCTCGCGTTACTAAGCAAGCACTGCCATTGAAC
TGCACACACCCAGTCTTTTTCAAAACAAAAAAATTTTTTTTTTCTTGAAAGGGAGCCATTCATACACTTCCCACCCTCGG
CCCCGAACCACCCTCCTTCCTGCTTCTGTTCCCCGGCCCAGGGGTGCGCCGCTGGGACGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es