Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D025C06
Clone ID D025C06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD025C06
Sequence
ATATGTGAAGCAAGAGAAAGGTGTGTGTTGTNNNCCCTGCAGGAGCTGAGAGCGCTCTCATACCTTGTCATACTTGGGTG
GTGCTATGTTATCAGGAGCTCCTGCTGGGTGAGGGAGCTTATATCTCTATACACTGTTGTAGAGACTGGACGGGGATTGC
GCCTATTTTGAGAGCACTCTGGGCTTCAGAATAAAATGGGCGTCGTGTGCACACGTACATACATACATACAATACACCTT
CTGTGAAGTTTTTGCTATGATTTTTTTTTCTCCCACATGAGGGTAATTTCTTATTTTATAAAAAGATTTATTTTTTTGCA
TTAGAGCAGGGTTTCTTTTCTCGCACAGCTATTTTTCCTCCACACTAGTGAGAGTGTTCACACAGACACACATCACACGT
CTCCCTTAGTGTGGAAGCTAGAGGGGAAAAGGAGGGCGCACAACTATAGTAGGAGAGCTGGGGGTGGGGTGGAGTGAGAA
AGAGTAGAGGGGTGAGTGAGATCAAGTGCTTTATATGCGTGTATGAAAATGTCTCACGGAGCTCCATTGTACACTGAGCA
TACAGGAGGAAAAATGATTTTATAAACTCGTGGGCACGTCTTAAGTGAAAGTCATGGAAATCCTGAAGTGCAGCTTCTGT
AGCGAGAATAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD025C06
Sequence
CAGTTTTGATCAGCTGTACTGACAGAGCTAGGCTAAGATAGTGTCCTGCTTGTTAATCAGGGCTAGGCAGAAGCAGCAGG
AGGAAGGATGACCCTGCCTCAGGAAGTTTTGAATGGCTTGTTATTTATAACCAGTATGCGGTAGAGCGGGAGAGCAGGTC
TCTGCTTACTGACAGGAAGAGTTTCAGCCGGCCAGTGTTCACATTTGAGGAAGCGGTTTATGGAGCTGACTGATTGAAGC
TCTGCGGAAGGAAGGATGAGAAAAGTGACTGCAG
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102934197..102934470 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es