Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0064
Clone ID CE0064
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0064
Sequence
AGCATGAGCTGGGACAGGGCAGCCGACGAGTCGGAGGCCCCCGTACTTTCGGAGGACGAGGTATGGGAGTTTTGCCTGGA
TAAGACAGAAGATGGTGGCGGCTCCCCCGCACGTGATGTTACAGACACTTGTGAGCCTCCATGTGGATGCTGGGAGTTGA
ATCCGAATTCCCTGGAAGAGGAGCACGTGCTGTTCACTGCTGATCCGTACCTGGAGCTCCACAACGATGACACACGAGTT
GTGAGAGTGAAGGTTATAGCTGGCATAGGCCTGGCCAAGAAAGACATTTTGGGAGCCAGCGACCCTTACGTAAGAGTGAC
ATTGTATGACCCGATGAGTGGAATCCTTACCAGCGTGCAGACAAAAACTATCAAAAAGTCTTTGAATCCAAAATGGAATG
AAGAAATACTGTTCAGG
Sequence Type mRNA
Unitrap ID UNI1215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72510361..72525338 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es