Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D024F11
Clone ID D024F11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD024F11
Sequence
GGGGGGTGGTGTGAGAGAGAGTGCACACTGTATCTTTTGATAAAGTCACTGAATTTCCCTTCAAAAGCTTGTGCTACATG
ATGCTGGGGGTCCTTAAGGATTGAAGGGTATTTGTATCATTGTGTGTTCATGTGGGATATGTATGTGCACATGTGGGTAT
GCAG
Sequence Type genomic DNA
Unitrap ID UNI30305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102052069..102052232 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032537 (Ephb1) NM_173447 Eph receptor B1 Gene [Source:MGI (curated);Acc:Ephb1-001]

 
Come back to gene ENSMUSG00000032537


For any suggestions or comments, please send an email to unitrap@crg.es