Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D024F08
Clone ID D024F08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD024F08
Sequence
GATCTGTTGTCATCTCTTTTGCTCCTCCCAAACTGAGGTTAGCACCCGGCCACCAAGCTCTTGGGGCCGAACTAGGTTGC
AGCGCTCTTCACTTTGTAATAGAAGTGCTTGTTTACAAGTCTCTCTTAATTTTGAGACAGTTACCTATCCTTATAACCTC
TTCACACTGCCTGATGATTGATCGCCAGGCACAGTGTTACACAGCTGGTGAATGGCGGTTTCAACTTCCGTTCCCACGTT
CTTTCATTATACCTAATTAGTGGCCCTCTGGAAGAATGGTAACAATAGTTACCAACTACTGAGTGTCTTACCTGAACTTG
ATAATCTATGCTTTAGCCTTCAACTCAGTAAAGTATGCGATGGTATACTTTTTTTAATGCGGGAGAAACAAACACAAGTA
CAAAGAACCTAAATGCCTTTCCAAAGCCCTAAGTGGTAAAACCTCACATAAAAAGTCAGGGCTGAAAATTCAAATTATTT
TTATCTTTGTAAACATGATTAAAGTCCTCNNNNNCTTATAATTTGGGCATCCAATAAATATTGATTCATCTCTGTATACT
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505225..108505784 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es