Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D024E08
Clone ID D024E08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD024E08
Sequence
GATCTGTTGTCATCTCTTTTGCTCCTCCCAAACTGAGGTTAGCACCCGGCCACCAAGCTCTTGGGGCCGAACTAGGTTGC
AGCGCTCTTCACTTTGTAATAGAAGTGCTTGTTTACAAGTCTCTCTTAATTTTGAGACAGTTACCTATCCTTATAACCTC
TTCACACTGCCTGATGATTGATCGCCAGGCACAGTGTTACACAGCTGGTGAATGGCGGTTTCAACTTCCGTTCCCACGTT
CTTTCATTATACCTAATTAGTGGCCCTCTGGAAGAATGGTAACAATAGTTACCAACTACTGAGTGTCTTACCTGAACTTG
ATAATCTATGCTTTAGCCTTCAACTCAGTAAAGTATGCGATGGTATACTTTTTTTAATGCGGGAGAAACAAACACAAGTA
CAAAGAACCTAAATACCTTTCCAAAGCCCTAAGTGGTAAAACCTCACATAAAAAGTCAGGGCTGAAAATTCAAATTATTT
TTATCTTTGTAAACATGATTAAAGTACTTGGATGCTTATAATTTGGGCATCCAATAAATATTGATTCATCTCTGTATACT
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505225..108505784 560
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]


SPLK-Sequence tag 3SD024E08
Sequence
AAAGTGCAGAAAGGATTCGTGGATATTCACTCAGTGATCATGTGGCCCTTGAAAGTCATTTCTCCCTTTGGACACAGAGA
GGAACTTTCCAGGCCTTCCAGGCAGCTAACAATTTTGTTTATAATTTATGCCCTGCTGCACTAACAGGTATCTGAGATGA
CCTCACACTTGAAACAAGAATGACAGGTACATTAAAGATATTAAGTAGGGATTAAACCAGGTGACCTTTTAGGTCTCAGT
ATGAGCCTAAATGGCTNNATCTATTAGCATCCTACACAGCCCAACTTGCTGTTGGACAAAAGGCCATATTTCTCCTTCCC
CTGCTGCTTTAAGCTTCTAGATGCCCTAAAATTATGTCTTTTCCATAAAATACTCCTTAGGAATAAGATTTCTTAATTAT
ACTGACCACCTGAAATGGAATTATTCTTTCATTTACACCATAAGAAAGAGTTAATTTGGGCTTTGCTTTTGCTTCAAATA
AGTCTGGACTTTTTGTCTTATCTTTCCAACTGCCAACTCTTTTCTTTAGGAATGTTACCTAAAATGCAAATAGTCACAAA
GGGCTAGTCCTGTGCTTNNNTTTAATATTCTCTCCTGACCTCCTTTTTGCAAGAAATTCCTTAAGTGCTGTGTTATTTCA
CTATAAGTTCATGGCTGTAGCTCTTTTGTGGATGTTTGAATGCAAGGTTGAGGTTTCTATCAGCACATTTCAGTCTGCTG
CACAGCTAANNNTGCCACACACCTAAAAGAACTGTTTGGATTCTACACACAACTCCCATGCAAAAGCTTTTACCTGCTTG
ACCANNGNAANNCNGGTTGGACCAAGGGAGNNAGCATANTTTCTAATTTTTTATTNNNNAAAAGGAATCAGCCNNNNNGC
TGCAANNNNNANNGGTCAGTTCTTTAANG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es