Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D024E04
Clone ID D024E04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD024E04
Sequence
ATTAATAAAATGGTCATAGAGCAGTATAACCAATAGTTGTCTATATATTGTTGGTGTTTAAGAAAACTTTACTTGCTTTG
GCTTTAAAACCTTTTTTAAACATTT
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62255193..62255297 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SD024E04
Sequence
CACAGATGCTGTTATCTGCTGGGCCATCTTGCCAGCTCCTCTGTTTTGAAAAAAAATAGTGTTATAGATTGTTATCCTTC
TTGAGATGTTATTATCCCTGAGTAGGTTCTTTTTACATTATATGTGTATTATATGTTATACGTATTTTGTTTGTAATATA
TGCTAATATTTGGTGAAATGTCAACATTTTTGAGTTCTGTCTGTTTTAAAACGTATAGCTGTAGCTCTTGTAACTCCTGT
ACAGCTC
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62254812..62255058 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es