Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D024C09
Clone ID D024C09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD024C09
Sequence
GATCTGTTGTCATCTCTTTTGCTCCTCCAAAACTGAGGTTAGCNNCCGGCCACCAAGCTCTTGGGGCCGAGCTAGGTTGC
AGCGCTCTTCACTTTGTAATAGAAGTGCTTGTTTACAAGTCTCTCTTAATTTTGAGACAGTTACCTATCCTTATAACCTC
TTCACACTGCCTGATGATTGATCGCCAGGCACAGTGTTACACAGCTGGTGAATGGCGGTTTCAACTTCCGTTCCCACGTT
CTTTCATTATACCTAATTA
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505526..108505784 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]


SPLK-Sequence tag 3SD024C09
Sequence
AGAAAGGATTCGTGGATATTCACTCAGTGATCATGTGGCCCTTGAAAGTCATTTCTCCCTTTGGACACAGAGAGGAACTT
TCCAGGCCTTCCAGGCAGCTAACAATTTTGTTTATAATTTATGCCCTGCTGCACTAACAGGTATCTGAGATGACCTCACA
CTTGAAACAAGAATGACAGGTACATTAAAGATATTAAGTAGGGATTAAACCAGGTGACCTTTTAGG
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108504971..108505197 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es