Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D022H01
Clone ID D022H01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD022H01
Sequence
GATCTGAGCACAGTTGTTTGCTTATGAGGCATTTACCAGTGTGCTTACTTTCATGATTTCTCTTCTTGAACATGTGGGTT
ATATATTCTAGCAAGTTCCAGTTTAGAAGGTCCTGATATGTGGAGAGTATGTGCATTGATTCCCTCCAACTTCAGATCAA
TAAATAAAGGATCAGGAGTGGCTTACAGGAAGAAAAAAAATGGCTTGTTAGAT
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154290274..154290486 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


SPLK-Sequence tag 3SD022H01
Sequence
ATAGATGGTTAACTTTTAAAAAACTATGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es