Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D022F03
Clone ID D022F03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D022F03
Sequence
GGCAGGGCTCTGGCTCNNNGGGTTGGCGCGAGAGTCAAAANNNCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGN
NATTCGCGTACTGANNTCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD022F03
Sequence
TTGGGGCTGGAGAAAAGATGGCTCAGAGCTTTAAGTTTCCAGCACTGAAGTCAGTCAGCTCACAGACACCGGTAACTCCA
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180442580..180442659 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es