Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D021A11
Clone ID D021A11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D021A11
Sequence
AGTCGGTTTCTGCCTGCGCTGCTGTGGGGTTGCGCGCTGGCGGCCGCGGCGGCACAGAGAAAGGAAG
Sequence Type mRNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857282..140857349 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]


SPLK-Sequence tag 5SD021A11
Sequence
CTCAGAGGAAAGGACGCTCAGTAGGGTTTTCNNNGCGATCAGCCTCTTAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD021A11
Sequence
TCATCTGCCCCGATTTCTCGCGGAAGGATTTGGATGCAGGCCCNNCTTTTTGGGGAGGGGTCCTCTCGGTGCCCTGCACA
AGCAAAAGAGTCTCTCTACGCCCCATCCGATTTTTCACTGGGGTCCTTTGGGCCAGCATTGGGAGCGCCTGGGGTCAGCC
CCGGCCACTCACACCTTCCCTCCTTCCCAAGCTGCCCTCCCAGGTTCGGGAGACAGGTTAAGGGCTGGGAGCGAGTACAG
GAAGTCCCAAAGTCAAGTGTTCTGAGCAAGGGGTGACTCAGAAGGAGGAAATGCGGCAGGTGGGGTTGCGGCTTCCCGCG
GTGTGGAGCCGTCATCTCGGGGCCACGGGGAGCCCAGGCACCTGGAGGTGGGGGAGTGAATCACCTGCCCCCGCCCCAGC
GTCTTGGAGCCACGCAAGGTGAGGGGGCCCGCACAGGTTGCCTTTGCTCAAGGCCGCAGCCGGGGGTGTGCTTGGGGGCG
TTGTCCCTCAGCTAGGGTCTCCGAGAGGGTGGGAATTCCTGCCCTGCCCTTNNNCGAGG
Sequence Type genomic DNA
Unitrap ID UNI10230

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857753..140858293 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es