Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D018H02
Clone ID D018H02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D018H02
Sequence
CATGATANNNCGCAATGCAGGGGGGATGATAATAATTACTGGGACATGCGCGTTTCGGCCGAAGGGGGCTAAAATTTCCC
AACTCCAGGAATTGGTGGCGGAGAGGGGGCAAGTCACCAGGGCTCTTCCCGGCGCCCCAATGCGCGCACCATGTCGAGGC
GCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGNNCAGGGCGAGCAGCCTCAGCAGCTACCGAGCCCCGACCTT
CCCGAGGCGCTGGCGGCGGAGGAACCCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD018H02
Sequence
GAGCAAGGCAAATGAAATCCGGGCAATAATTAGCAGATCAAAAAATCCGCAGGTGGTCAAGGAGAAGNNNGCTTACAGTA
CTTAAAGGAAAATTAGCATTTTCTCAAAAGNNNTTCCAAATGCCCTTTGTGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD018H02
Sequence
AACCTTCAGCTATTACGATTCCCAGGTTTTTAGTAATTTAGCGCTCCTCGCCATCCTTCATCGACCTGCCTGTGCCTGGC
TTAGTTAAGGTTTCAAGCTAATTCAGTCTTCCCCCCAAAAGGNNAGGGGGCTTCTTTTTTATTCATTTAATTGCATGTAA
AATGTGCTCCCTAACCCTCGGAGGTTCTCCACTGCCAGTAAACGATACTTTGTCATTGGTGATGGGGATTAAGGGGATTT
CAGTTTAAGTAGGGGACCGGGAGCCGTTTTGGGGGAGCTGAGGCATGGTTATTTTTGAATCTCCTCCTTTTGGATGTAAA
ATGTCAAATGAGAATTTGGGGAAAAGAATTTTGGCAGGATTCAGTACGAGGAAGCTCGGCGTTGCATTCTGGGTGTAACC
TTGCCTAGGTGGACTAGTGTACCCCCACTTATTCACCCAGCTTTTTGGG
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589716..168590164 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es