Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D017H10
Clone ID D017H10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D017H10
Sequence
GCAGCGCGCACAGTCCTTCTGTCGGTTGGTCTGGAGCGNNGCAGCAGGAGCGGGGCCGTGAG
Sequence Type mRNA
Unitrap ID UNI4500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156022472..156022533 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038116 (Phf20) NM_172674 PHD finger protein 20 Gene [Source:MGI (curated);Acc:Phf20-001]


SPLK-Sequence tag 5SD017H10
Sequence
GATCTATTCTGGTTGGCCAGAGCCCTTGTCTGTCTAGCTCAGCATGTCAGCCCCTTCCTCCTGCCTCAGGGGTTGTGGGG
CTCATCCTTTCTTGCTATTGACAAAAACCATGCTTCTGTCCATAAGCCTGCACCGTACAG
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110367065..110367204 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es