Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D017E07
Clone ID D017E07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD017E07
Sequence
TGTGTGACCAACTATCTTGATGATTGGTACAGGCTGTACAGAATTCTGTCTGTGGTACTAGAGTTACTCCCNNNATAATT
TAGACGGTAGCTGACCTAATGAGTTGGTGTATTTCACTGNNAAAAAAATAGCTTGGTCTATATGTCGAGCATCAGTAGAT
GTAGAGCAGAAAAATCTCTCTACAGAGAGGCTATGGCCTCTACTGAGGGAGCTCGAAGCTAAGNNNCTGCCCCTACCTGA
AGGCGGTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD017E07
Sequence
CCTCCTTCCATTACTCTCTTCTCTCTTCTGGGCAGTTCATCTTTTCCTGCGCCTTTCAGGCCTAGACACCGGGAGCTTTG
TGTTTTCCTGGGTGCTGACTTTTGTTGTCAGATGGCATTATGCTGTGCTTAACTTCTGGTTTAGTGTGCTGCTTTGTGTG
TATGGCATCCACGGAAATGAGTGTGCTTGGACTGACGACTGATTTAGCGCCCACTATGAAGGG
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115474884..115475106 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es