Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D017E01
Clone ID D017E01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D017E01
Sequence
CTTTTCTGAGTCGCTGAGGCTGAGGGAAGGATGTAGGTCTGGAGAGATCCTGGAAGCCTCTTGCTGAGGCTGAGGGAAGG
ATGTAGGTCTGGAGAGATCCTGGAAGCCTCTTGCATCATCCATCTCTGCATCTGTCCTGGCTGAGTGTCTTCATTCTGCC
ACCT
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62355443..62355606 156
NO GENE  


SPLK-Sequence tag 5SD017E01
Sequence
TTTAGATGTTGAGTAAGCTTTATATCACTGTGGCATAATGAGTTAATCAGCTTGAAAGATTCTTAGTTCAGAGGCTTTTC
AGTTTG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97854453..97854538 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SD017E01
Sequence
CTGTGATGATGTAGTGCGTCATTGCTAGAGCANNCTGCCTACCTTTGGCAGTTGGGGCAAACAGAGAAAGGGGAGCTGGG
GTCCCACTATTTCATTCCAGTATCCATGCTTCTGGTGATGGAGCTTCCTCCCACTAGAACCTGCCTCTTAAAGGTC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97854564..97854719 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es