Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D017C02
Clone ID D017C02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D017C02
Sequence
TTCCGNNNCAATCCGGGGCAATCCAGTAATAAAGGTCGAAATGGCCGGTTTATATGACGCTTTGTGAGGCCCGGAACTGA
CCTTCGTACTGAAGTCTCTGGTCTCCACTGGCTGTGGCTTTCCCTGAAGGAAATCCTTAAGATATTTCTGGAAAGGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD017C02
Sequence
GATCTCATTAAAACTCTTAACATTTTAGTAATCTTTTTACATCAGAGATAGCCCGGGAGACTAGCATATCTGCTTCAGGA
GAATTCGGGTAAGNNTTGCTTCTCTCCTGAAGTGCTTCTGCTTTAGGAAAACAATGTCTTATTTGGGAAAAAAAATATTT
AAGAGGTTTGT
Sequence Type genomic DNA
Unitrap ID UNI30301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54023029..54023200 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


SPLK-Sequence tag 3SD017C02
Sequence
TCATCTTTCCAGCCCTGCTTGAGGAATTCTTTATACATGACTTAAATTTTTAGCCAAAAGCCCAAATAAGTGGTGTAAAG
AGTACCCTATTCAACAGGACTGGATTTGCTTTTAAAGAATTGAATGTGTGTGCGACGCTACACTGTGTTTGTGGAAGCCA
GAAGACAGTTTGAAAAAAGGGTATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es