Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D017B02
Clone ID D017B02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD017B02
Sequence
TTTTTTTTCTCAACAAGTGTGTGTTGATCACACAAGCCATGCGCGTAGGACCTGGATTTTTGAAAACACAAATCTGGATT
ATGGTGAAGGAGACGGATGTGTAAACATCACGGGACAAATAGAGTTGTCTGAACAAATTTCTTTGGAAGTAGAAGAAAAT
TTATTTTCTCCAAAATCCAAGAGTGATCTTTGAGCTGGGGATG
Sequence Type genomic DNA
Unitrap ID UNI12956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29400354..29400556 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]


SPLK-Sequence tag 3SD017B02
Sequence
ACTGATTGAAGGGAACCCTGCTTGGAGCCTGGTCTGCCCTGTCTACTGACTTGAGCCCCATTTTGTCTGCCCTTNNCTCC
TGAGTGTAGACATTAGGAAGGCACGCACCACTGCTCTCGCTCCCAGTTCTACAGAGTGCTCACATTGCTGGACCTCCTGA
ACTTGGGCCATACAGATTCTCCCCAGAGCTCAGTGGGTAATGTACAGCAGGAGCCCCCTGCCTTGTTTTATCCTTAACAG
CACTAGGAGAAGAGAATAAAAGCACTCGTATGGGTGTATGTGGACATTTGAAGTAACCAGCCTATTTGCTTTACACATTC
TCTTTAGATTTGA
Sequence Type genomic DNA
Unitrap ID UNI12956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29399686..29400018 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]

 
Come back to gene ENSMUSG00000024007


For any suggestions or comments, please send an email to unitrap@crg.es