Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D016H11
Clone ID D016H11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD016H11
Sequence
GATCCCCTTTGGGCTCTTGGGATTTAAAGCGGTCATCACAT
Sequence Type genomic DNA
Unitrap ID UNI25978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120442128..120442167 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]


SPLK-Sequence tag 3SD016H11
Sequence
CATTGGAAGGGAGAACAAACAGACCCTTGTCCTGCACGTGGCTAACATACAGAGCATCTCCCTGTCGGAGAACTTACCTC
CATGACCCAACCCAGTAAGATGAGAGCCTGGGCAGCTAGGGACAGCAACAGGACCCCAGGGATTTAGTGTTGCGTCTGCC
AGTTCAGTTCGGTCTGGAGGCTTATTCTTAGTGGGGAGGAAAGGTGTTTTGCTTCTCTGAGGAACAGGCTGTGGTCCCAT
TTCGTTGCTTGGGGTTCTAGTCCTCTCAAATGGGCCTCTGCGTAGGGCAGTGGCAGCATCCTCTCAAAGTTCCAGTCAGG
TGTCCTGCAGGTGTCAGGGTCTGCCTAGGGTGGAATGCCTCCAGGCTGTCACAGTCCTGCTCATGCCCCGCCCACAGGTG
TCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAG
ATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAG
Sequence Type genomic DNA
Unitrap ID UNI25978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120441575..120442105 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]

 
Come back to gene ENSMUSG00000025132


For any suggestions or comments, please send an email to unitrap@crg.es