Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D016G04
Clone ID D016G04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D016G04
Sequence
AANNNCGGGACGTTCCGGGAAAATACGCCTCTTGCTTTTGCATTAATCTGCGTCTCGGTGTCTCACTCCGGGGCATCTCG
AAAGACTCTACAGGAGCAGGTAATTCACTGGTCCACAAGCGGTCTCCTTTACGTCGAAACCAAAAGACCTCAGCATCCTT
GAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAGCCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTTAGCTA
GATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAG
GACAGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAACAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108489806..108510237 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 5SD016G04
Sequence
TTTTTTTTTTTAAAGAACAAAATGTTCTTAAATGTTAAGGAGACAGTAATTTCTTGCTTAGGT
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108515102..108515164 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SD016G04
Sequence
ACTTTTGTTGCAGTAGAATTCTCTGTGTACAGTATTAGACACTATATTTCTAGATTTAAGCCATGAAATAATTGTTAATC
TTTCATAATAAATACAAAGAACTGTTCTTAAGTCCAGAAAGGAAGCACATAACTGCCATGACTAGTAGTCTCTGTAGCCT
TGCGTTACTAATATAAAAAAGATGTGAATCTGAACCTGAGTAGAAGTGTTCTGCAGAGAAGTTTTAGTGTTAATAAATCT
TTCCCAG
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108515191..108515437 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es