Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015H09
Clone ID D015H09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015H09
Sequence
TTGTTCAGATTCNNNATTTTGCGAGGCAGCGGCAGTGGCGGCGGCGGCGNNGGCTGGAGCCTCTGATTGGGTTTCGGGGT
CCGGTACTGGAGCCAATCAGCGCGGGCAGCGAACCGGGGNNACGAGGCACG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD015H09
Sequence
AATGTTCCTTACAGCTATTCCAGCCCTCTTGCCCACTTCAGGCTCCATTCTGCATTTAATCTGAGACGATGCAGACTTAG
GACATTTAGCCAAGAAGAAAGTTTTATAGGAAAGC
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48546397..48546511 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es