Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015H07
Clone ID D015H07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015H07
Sequence
CTCTCCTCCGGGGGCGTAGGCGAGGCCTCTTAGTTCTGCGGCACGTGACGGTCGGGCCGCCTCTGCCGCNNNCTCCACTC
CAGCACGGNNNCGGGTGTGCGGGTGGGAGAAGGTGAGGGAGCCGCCAGTGGTCCCCGGGAGGCTCGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD015H07
Sequence
TAAATCCAGAGATAAGCGTTACAGATTAGAAAATAACTTGCCCAAAGGGAAGACTGGACCATAGCATCCTGATGAGGGAG
TAGAATGTACTAGAACGTGTACCGCTTGAGAAACTTAAGGCTTAACTATTAAAGCACCTGCCTATTCGGTGGTGGATAGA
TAGTAATCCAGTGT
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138418..50138591 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]


SPLK-Sequence tag 3SD015H07
Sequence
CTTAAGAGCAGGAGATACAAGCGAAAGTTCAGTTAGTGAGGGGAGGAAACTGAGGCCTAGAAGTTTGAAATG
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138331..50138402 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es