Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015E06
Clone ID D015E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015E06
Sequence
CNNNNCCGGGGNNGGCCGCGGCAAGATGGCTGCCTGAAGGAGAGGCCCCGGCAGAAACTTGAAGNNNCAAGGGCCCCAGG
GACTGGAAGAAATCACATTGCCTGCTTGGAAAGAAGANNGTAGCAACTTNNCCCAGCCCAACCCCAGAGCGG
Sequence Type mRNA
Unitrap ID UNI10807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46419295..46419950 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]


SPLK-Sequence tag 5SD015E06
Sequence
GAGTGCTTTGGGACTCATGTTTCCTAGTGTCTTAGGGACTGAAAAATGTCCGGGCGAAACCAGAGGAATGTATGCAGCTA
TTGAGTAAGCCAGACTTCCAGGCCCCTGTGTCTTAGGGCTTTGGTCTT
Sequence Type genomic DNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46410858..46410986 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]


SPLK-Sequence tag 3SD015E06
Sequence
CACCCTCTATTCTTCCAGTTTCTTTTCTACTGTAGTTGCTGGGAATGGTCTGTAGGTACCACCTTCTGAACAAATACCAA
AGGAATTGGTTTTAGCAGTTAGAACCTCATGAACGGTATGCATGG
Sequence Type genomic DNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46410685..46410807 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es