Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015E05
Clone ID D015E05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D015E05
Sequence
GGGGGGGAGATTCGCCATTTTGCGAGGCAGCGGCAGTGGCGGCGGCGGCGNNGGCTGGAGCCTCTGATTGGGTTTCGGGG
TCCGGTACTGGAGCCAATCAGCGCGGGCAGCGAACCGGGGNNNCGAGGCACG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD015E05
Sequence
GATCTGATCCAGTACCCAGAAGTGCACTTTACATGAGGAAGCCTATTTTCAGCGCCACGCTTTTGATTGGTGATGGAGGG
TGATGTCTCAGAGAGGAAAGACTAAAA
Sequence Type genomic DNA
Unitrap ID UNI543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48547782..48547889 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


SPLK-Sequence tag 3SD015E05
Sequence
ATAGTGCGGTTGNNNNCGAAAGGCCGGGAGTACTGAGTTTAGGCGGGAAAGTCCAGTTGGTAAAAACCTTTGCAGGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es