Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D015D08
Clone ID D015D08
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD015D08
Sequence
GGTCCAGTATGTTTCGGTTTGGATTTGGAATTAAGCTGGCCTTGTTGCGAGAAGCAGNNNNTTTCGCGGGGGTAGACAGT
TCTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD015D08
Sequence
GCAGTGAGGACTGGGCGGGGATGGGCTTTGGTATTAGCCGATAGTGAGTAAGTGGTTAGGAAAACTTGGGGTGAGTTTGG
GTTAGGTGCCGTCGCGTTTAGGAAGCAAGG
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43574632..43574742 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es