Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D014F07
Clone ID D014F07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD014F07
Sequence
GATCTCGGGGGACTTTTCCCCCTCTGCCCGCAAGAGGGACCCGTAAGATGAAAAGCGTTTCAAACACGGTCGGTCCGGAG
TTAGGGAAAAAAAGAAAAGAAAGAAAAATAAACAACAGAGTGAGACCCTCGGTCTGAGTACCGCTCCATCCATTCATGCG
CTCAACTATTCAAACTGCCGGATGGTCGTGAGGGGTCCCGAGGGAATTCCATCCTTGAAAGTATGAGTTGGGCAAGTGAT
GCGTGCTCGAGAGGCGCCCAATAAATGCTTTCACTTAATTATTTGAACG
Sequence Type genomic DNA
Unitrap ID UNI16694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131136100..131136388 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045427 (Hnrph2) NM_019868 heterogeneous nuclear ribonucleoprotein H2 Gene [Source:MGI (curated);Acc:Hnrph2-001]


SPLK-Sequence tag 3SD014F07
Sequence
ACACGGATGCTTAACTCATAAGTTTTGGGTACTACGCTAGGAAACAGAAGCCTGGTGGCCTTCTCAGGAAACGAAAGGCG
GCCTAACCTCTCACCCACTAGTGAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000045427


For any suggestions or comments, please send an email to unitrap@crg.es