Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D014D09
Clone ID D014D09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD014D09
Sequence
CTGCGGTGCGCGCCGGGCCGCGTAAGTCCGGGCCGGGGATGCTGANNNCGGGTACCGCCCGCTCTCTCTGGTTGCAGTNN
NNCCTTGGGGCGGGTCGCTCTTGCGCGTCGTGCCCCGGCGCGCTCTCCTTCCGTCAGCTGGGTACTCCTGCCAGTGCTGG
GATAGCGAGTTCCCGCTTCATAG
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32420846..32421028 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SD014D09
Sequence
CCCCNNNGCTCTNNNTAGAAAGAGGTAGAAGATTTTGTTCACAGGGAGAGAGCTTCCATTGCACGCCTGCTCCAGGCTGG
ACCCAGGGGACAGGAAGGGTGACGAAGGACCAGGAGTCCCTCTCGACCCACCCACTCCCAACCTGGAAGCCTACTCTTTG
GGTGCTTTGTTTTGATGGGTCTCTGCTTGCTGCCGTCCCTTGCAATGGCTTCTTACTTGCAGGAGTGTGTCGGTTTAGGG
TGGGGATGTTGGAGAGTTGTGATTCAGCAAAATGACCCCCCCCCCCCTTAAACACAAAAAGGGAAATAGCCTTTAAAAAA
AAAGCCCCCAAGGCCGAGCTGGGTTGGAAATGGGAAACCCCCCGTTAGGGTAGGGGACAGGGGGAAAACTTTTGCTCAGG
CCGGGGGGGGAGCCATGGGCCTCTGCTGATTGGCTGACCCCCCTGTTACTCAAGAAAAGGGTTTTTTTGTTTGTTTTTTT
AAAAGGGTTTTAAGCCGGCTGGTTAACTTGTTAATGCTTTTCGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es