Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D014D06
Clone ID D014D06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D014D06
Sequence
CAGANNANAGAGGAGCTGCGGNANGTCAACNNNCCCCTGCCTGTGNNNATCGATAAGGGGCGCACNCTGGAGNCGNAGNN
NAGCNNCTGCAGCTGCAGTGCCCNNAGCGCGAGGAGGGTCGCGGCCGCGAGCTCACCNNNCTCAAGGCTNNCTACGAGAC
CGAGCTGGCCGACGCACGCCGCGCTCTGGACGACACGGGCCCCGAGCNNGCCAAGCTCCAGATCGAGCTGGGCAAGTTCA
AGGCCGAGCACGACCAGCTGCTGCTCAA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD014D06
Sequence
GATACATATTTGCCTTTCTCAGCCCCTTTACTTGCAGCAAGCAGGGCTACTCATTTTGGGTTTTCTTTGGGTTTCTTCAC
CTTTGGTAGTTTTTGCTCACCTCAGTTCAATGTTGATCAGCTTAGGGACACCTTCCCTGACTGCTGACTCAGACTTTTGT
GACAGGACACGTGTGACTGTCCAGGTGTGCATGAGTACAGTTCAGGGCTTGTGATGGGACGACCGCCTTCATTCCTGTCT
TTATAGCCTAGAGTAAAGGGCGTTACGGACTGGCTGCCGAACATTCTGCTGTTCCCAGCATCCCTTCTGTCCTTAGATGT
TGGCAGGTCCACTTAGATCATTAGACTTAGGTATTTAAAATAGTCCTTGTGCTGTGTTGGAAATGCAACATGTTAGTCCA
TGTGACTAGTAGATAGAGAAATGATTTTATTATATATTAGTAAGTACATAGTTGGTTCTCTACACCCAAATGAATTCAAC
TGAAAATACTGAAAATACACAAAAATCNNNTTTATACTACACATGTAAG
Sequence Type genomic DNA
Unitrap ID UNI10639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56878587..56879115 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]


SPLK-Sequence tag 3SD014D06
Sequence
AGAGATGCTCTGTGGTTCAGTTTCGTCTTAGTATTTTCCTAGTTTTAATGTGATTTGTTGGGATTGGCTTGTTTCTTACT
GGACAATTTGTGCTCCCTTCAGTGACCTTAGCAGCTCTGACCGTGCCCAGCATGGTGTACTCTTTGAGTGTGTCAGAGGA
GGCCCTTCTCATGGGAATAGAGTTCACAAGATTAAGATTCTTCTGGGTATTTTGTATATTATATGCATTTTAATAGCAGG
AAAGTTGATTAGTTTTTCTCATGAGAAGCACGTGGCTCAGGTTCACACAGTATTGAAAGTGATCAGTAACCCGGAGTGGA
GTGAACTCGTCATGGGGAACTTGAGCCTATTGTGAG
Sequence Type genomic DNA
Unitrap ID UNI10639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56879375..56879730 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es