Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D010E05
Clone ID D010E05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D010E05
Sequence
CACACCCAGGGCNNACACAGAAGAGAGAATGAACCAGAGGGACACGCTGGTGCATACTATTTACCGGGGGATGTGGTGGC
ACAGTGGGAGCTATTCTGACATGTCCACTGGAAGTTGTCAAAACACGGCTGCAGTCTTCTTCTGTGACACTGTATATTTC
TGAAGTTCAGCTGAACACCATTGCTGGAGCCAGTGTGAACCGAGTAGTNNCCCCTGGACCTCTTCATTGTCTGAA
Sequence Type mRNA
Unitrap ID UNI10856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97000494..97011381 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


SPLK-Sequence tag 5SD010E05
Sequence
GACCTCTTCATTGTCTGAAGTAAGAGCAAAAAGTCNANGGGTTTTGTTTTTGATGCTGTGATTGTAGTGATTCCCACATG
CT
Sequence Type genomic DNA
Unitrap ID UNI10856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97000432..97000512 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]


SPLK-Sequence tag 3SD010E05
Sequence
TTATCTTCCATATTTTATAGGTTCTTTAGAAACTCAGAAGACTGAAGTATGAATCGTACTTCTTAATGGAGATAGGCCAT
AAAGGAGTAGAGCAGCTAATTATAAAGATTGCATGAAATGGAATATTTTCAAATTGTATATATTGTAGAATATTTTTCTA
CATTATCCAGTGGGATTCTTTTCTAAAGGTATCATAGGATTGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es