Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D009H12
Clone ID D009H12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D009H12
Sequence
TNNCCAGACCNNACCCACCCCNNCCCAATCNNCCACACAACNNAACCNNANNACCCCATCCANNCACTCCCGATCCCNNA
TCCCACACACACATACAATACAACAAACCACTACNNCTCGCNNCTCCCACAGCAACTCACCCCACTCGCCCCCCATCTCA
CAAATCCTCCTCACNNGCTCCCANNCTACTCACCAANNACCNNTCACCCCCNNTNNATCNNGCCANNCATAAACACATCA
CACATTCACAACACACTCAAACCCNNCACACTACTCAGCCCCCGCACTCCCANNACTACCCTCCATCACCNNNNCCCCAC
CACCCCTCCAACNNTCTCCNNTTACACCCANNCCNNAACATCCCATTCCACACCAGACCACAACTCGGTCAGACACCANN
TCTTCTCTNNCCACATATCCTCAATATGNNCCCCCCCTCGACCCTCCTCCCACACNNATTCACATACACCCACGCTCCAT
GTCCTACACTCACCNNCNNCACATCACCCACNNACTCNNCCCCGAACNNATCCCACACACCTCACATCCCTTTACCATAA
CATAACTCCATAATACCGCAANCAAGATTCCCTANNNNCCCAACATCGCACAAACTCAACAANNCACACACACCNNGCTC
ACCCACCCCCACTGCCCCTACCACCCAACATCCCCACGCNNTCACTCCCCNNCACAACGCCCCACCTCACCTCTTCCTCA
CTCCCCACTCTACAACCACNAACTCCTTCCCCACCACAACTACATANNCCTATCACAAGTTCAACTCGCATCATCCTCCC
GTCATTACANNCTCCACACCTCTAACACCNNCCTTCACCNNCCCACCCANNCNNNCCCCACCTCCCCTCACACTCCCCAT
CCGCAAACCCCACCAAAATCCCCACACACCCCACNNAAACAAACCTCCCCACCACACCCCTCCCCATCAAACACACCCGC
ACCTGCCCNNCGGGTCTCCGTGNANNTTGATNNNNTTGAGTGGGATAAACGGGAGTGGGTTAGAGTTTATGAAGATTTTT
CAACTTTCTTGGTGGAATATCACTTAATCTGGGCCAAAAGGAAGGACCCTAGCCAGACTCAGGGATCAAAGAGCAGACAA
ATTCAGTGGCCTGCACTG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD009H12
Sequence
TTGGTTTTGCTCCCTAGCCTTAGGAATGANNNTNNNTGTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD009H12
Sequence
TTAGAAAGAGGTTTTCTCGTGTTGACGATCATTTATAACACTAAAAATTTAATTTAAAACTGGAGCTGAATTGTTTTGAG
TGTTTTGGCAGATGTGTTTCAAATTAGACAGCAGTGTTTTAAGGGGACTTGGAGCATTTGTTTTGTGGGG
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649193..66649341 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es