Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D009H01
Clone ID D009H01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D009H01
Sequence
GTATACACCCAACCCCACCACAGCACAANACTTTATACACCTAAACACACAGCCTNNAGACCCCGAACTCTACTTTTCCT
TTGACTTCAACCTCCAAGGAGTTCCACCACTTTGGGCGTGCCGGCTTCACTCTCATTAAGTGAAA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD009H01
Sequence
GCTGGAATGATCTCAGCCCTTGCAAGGATGAGGCAGAGTAACCACCCAGGCACCAGTTTAAGGCTGAGGTGAGGACCATG
GAGGAATTGGCAGGGTGGGAAGACTCACAAAGCAATACGTCCTCCATTAAATTGCCCATTAAGTGGCTTTAATCAGGAAC
TTCTTTAGGCATTTCCTTGTGGATTTTTAGATAGCATAATTTTATCTAAAATATCAAAGGACTTTCATCTAAATACACTT
CACATGTTCTATGATGATTGCTACCTAGGCGTGGTGG
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56102668..56102943 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es