Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D008H11
Clone ID D008H11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D008H11
Sequence
TCCTTCCTGTGTGGAAGCCGCAGATCCCGGTGAGCCCTCTCACCTGGCGCTCTCTCCATCCTCGGCGCGATAACCATTGC
AGCAGGCTGGAAGNNATCGCGCCCCCGACCCTGGGCGAGAGAACTGTGGGGGAGGAAG
Sequence Type mRNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35770487..35770625 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]


SPLK-Sequence tag 5SD008H11
Sequence
TTTGTACATGTATACCACACACNNGNANCACANNNNACANNCCTGTGTATGTACACGAAACANNNGNNCNC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD008H11
Sequence
TGCATCACAGCGTCCACAAGTGCCACAGGTCTATTGTGGAGTCACTGGGGAGGCCCTTCCCCCTATCCTGAGTGAGACTT
GCTGAAGGATAGGTAGGGTCATCTAGAGTTCACCAAGGCCTGTCATGG
Sequence Type genomic DNA
Unitrap ID UNI38

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35784572..35784700 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022849 (Hspbap1) NM_175111 Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

 
Come back to gene ENSMUSG00000022849


For any suggestions or comments, please send an email to unitrap@crg.es